mouse monoclonal anti human bmp4 antibody  (R&D Systems)

Journal: Progress in Orthodontics

Article Title: Identification of bone morphogenetic protein 4 in the saliva after the placement of fixed orthodontic appliance

doi: 10.1186/s40510-021-00364-6

Figure Lengend Snippet: Saliva protein expression after fixed orthodontic apparatus placement. A Left panel shows proteins expressed in the control samples, which include pre-placement sample pools (n = 12), and control samples (n = 6) (no orthodontic therapy). The center panel presents proteins expressed in the early and lag phase of the OTM, which includes post placement (0 h), as well as two and then seven days post therapy (n = 12). The right panel shows proteins expressed in the post-lag phase of OTM at 30 days post placement when bone remodeling occurs (n = 12). Proteins are grouped according to the physiological processes they are part of. B Proteins interaction network related to saliva BMP4 in the post-lag phase, as predicted by STITCH software, version 5.0 ( http://stitch.embl.de ). Line thickness indicates strength of data support. BMP4 - bone morphogenetic protein 4; BMPER - BMP-binding endothelial regulator protein; FGF5 - fibroblast growth factor 5; IGFBP3 - insulin-like growth factor-binding protein 3; CKAP4 - cytoskeleton-associated protein 4; MYC - myc proto-oncogene protein

Article Snippet: Heparin-enriched proteins from saliva pools were separated by SDS-PAGE and analyzed by Western blotting. rhBMP4 was detected using a mouse monoclonal anti-human BMP4 antibody, available as the capture antibody in the ELISA DuoSet kit (cat. no.#DY314 , R&D Systems) (see Supplementary methods for details).

Techniques: Expressing, Control, Software, Binding Assay

Journal: Progress in Orthodontics

Article Title: Identification of bone morphogenetic protein 4 in the saliva after the placement of fixed orthodontic appliance

doi: 10.1186/s40510-021-00364-6

Figure Lengend Snippet: Protein interactions identified by STICH version 5.0 related to bone morphogenetic protein 4

Article Snippet: Heparin-enriched proteins from saliva pools were separated by SDS-PAGE and analyzed by Western blotting. rhBMP4 was detected using a mouse monoclonal anti-human BMP4 antibody, available as the capture antibody in the ELISA DuoSet kit (cat. no.#DY314 , R&D Systems) (see Supplementary methods for details).

Techniques: Sequencing

Journal: eLife

Article Title: Direct reprogramming of human smooth muscle and vascular endothelial cells reveals defects associated with aging and Hutchinson-Gilford progeria syndrome

doi: 10.7554/elife.54383

Figure Lengend Snippet: Figure 3. iSMCs reprogrammed from HGPS fibroblasts show signatures of vascular dysfunction. Heat-map representing DE genes between iSMCs reprogrammed from healthy (N = 3) vs. HGPS (N = 8) donors. Z score = ± 2. DE genes with log2FC > 1 and FDR < 0.05 (A). ELISA measurement of BMP4 in the serum of HGPS and age-matched healthy human donors (B, Student’s t-test with p=0.4 for normal vs. HGPS 5–11 y.o.; p=0.575 for normal vs. HGPS 12–18 y.o.; Student’s t-test with p=0.04 for 5–11 y.o. vs. 12–18 y.o. normal donors; Student’s t-test with p=0.4 for 5–11 y.o. vs. 12–18 y.o. HGPS donors), as well as in the serum of HGPS, young (age-matched) and old mice (C, ANOVA with Holm-Sidak test with p=0.79 for young vs. old; p=0.001 for young vs. HGPS; p<0.001 for old vs. HGPS). Quantification of vascular permeability in presence of iSMCs reprogrammed from young (N = 6), old (N = 6) and HGPS (N = 6) donors. At least N = 95 independent measurements per condition in three biological replicates. ANOVA with Holm-Sidak test with p<0.001 (***) (D). Schematic showing the vascular permeability assay in presence of antibodies specifically blocking secreted BMP4 and Jagged 1 (E). Quantification of vascular permeability comparing iSMCs from HGPS donors (ctrl) or the same cells treated with antibodies blocking BMP4 or Jagged 1. At least N = 60 independent measurements per condition in three biological replicates. ANOVA with Holm-Sidak test with p<0.001 (***) (F). Quantification of the effect of BMP4 and Jagged one blocking antibody on Y658 VE-cadherin area fraction. N = 6 independent measurements per condition in three biological replicates. ANOVA with Holm-Sidak test with p<0.05 (*) or p<0.01 (**); p=0.897 for BMP4 Ab vs. Jagged1 Ab (G). Representative images of Y658 VE-cadherin in presence of BMP4 and Jagged one blocking antibodies (H–J). Scale bars: 25 mm. The online version of this article includes the following figure supplement(s) for figure 3:

Article Snippet: DOI: https://doi.org/10.7554/eLife.54383 12 of 21 Continued Reagent type (species) or resource Designation Source or reference Identifiers Additional information Antibody Anti-human Paladin (Rabbit polyclonal) ThermoFisher Cat#PA5-53591 RRID:AB_2645183 IF(1:100) Antibody Anti-human GSTM1 (Mouse Monoclonal) ThermoFisher Cat#MA5-17085 RRID:AB_2538556 IF(1:100) Antibody Anti-human BMP4 (Mouse Monoclonal) R and D Systems Cat#MAB3552 RRID:AB_2065677 Blocking (2 ug/ml) Antibody Anti-human Jagged 1 (Goat polyclonal) R and D Systems Cat#AF1277 RRID:AB_354713 Blocking (1 ug/ml) Sequencebased reagent CD31 forward This paper PCR primers TGGTCAAGAAAAGCAACACAG Sequencebased reagent CD31 reverse This paper PCR primers GATTCGCAACGGACTTCG Sequencebased reagent CD31 forward This paper PCR primers ACAACGAGGGCATCATCAAG Sequencebased reagent CD31 reverse This paper PCR primers GAAGTGGTAGAAAGGCTGCTG Sequencebased reagent BMP2 forward This paper PCR primers CATGCTAGACCTGTATCGCA Sequencebased reagent BMP2 reverse This paper PCR primers TGTTTTCCCACTCGTTTCTGG Sequencebased reagent BMP2 forward This paper PCR primers GCCCTTCGAGCACCACGCA Sequencebased reagent BMP2 reverse This paper PCR primers TGGCTTGTAGTGCCGCTGCTG Commercial assay or kit BMP4 ELISA Kit Sigma-Aldrich RAB0029 Software, algorithm Fiji https://fiji.sc/ Cell culture and human serum Cell lines used in the study are reported in Supplementary file 1.

Techniques: Enzyme-linked Immunosorbent Assay, Permeability, Blocking Assay

Journal: PLoS ONE

Article Title: Furin , a transcriptional target of NKX2-5, has an essential role in heart development and function

doi: 10.1371/journal.pone.0212992

Figure Lengend Snippet: (A, B) Right side views of E9.5 control and Nkx2-5 IRES-Cre/+ /Furin fl/fl mutant embryos. (C) Measurement of OFT length as shown in A and B with black bars. (D) Measurement of OFT angle as shown in A and B in red (n = 29 for control embryos and 17 for Furin mutants). *P<0.05 for unpaired Student’s t test. (E-F) Sagittal section showing ectopic expression of cTNI and MF20 in the dorsal pericardial wall (DPW) of mutant and control E9.5 embryos. Red brackets indicate the extend of the differentiated cells. Location of atria and OFT is shown. (K-P) Sagittal section showing PH3-positive cells in the DPW of control and mutant embryos. ISL1 staining identify CPCs. (P) Quantification showing a reduction of mitotic index in mutant embryos compared to control while it is unchanged in the underlying endoderm (n = 3 for each genotype). (Q) Western blot analysis of BMP4 and pSmad1,5,8 expression in protein extract from 3 pooled body walls of E9.5 control and mutant embryos.

Article Snippet: The antibodies used were the mouse BMP4 (R&D system, MAB757, 1:500) and rabbit phospho-Smad1/5/8 polyclonal (1:1,000; Cell Signaling).

Techniques: Control, Mutagenesis, Expressing, Staining, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: Sequence of N-terminal region is distinct in different BMPs. A, amino acid alignment of the entire N-terminal region of BMP2, BMP4, BMP5, BMP6, and BMP7 using the first conserved cysteine in the cysteine knot as a reference point (shaded in gray). The basic amino acids Arg and Lys are boldface and underlined. Note that the predicted HS-binding domain in BMP2 and BMP4 lies directly upstream of the first cysteine, whereas the predicted site in BMP5, BMP6, and BMP7 is further upstream. B, evolutionary N-terminal amino acid sequence alignment of the five BMPs from Xenopus tropicalis to Homo sapiens. All five proteins are highly conserved. Predicted HS-binding domains are boldface and underlined.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: Sequencing, Binding Assay

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: Synthetic peptides from N- and C-terminal regions. A, amino acid sequences of the synthesized N-terminal peptides that span the predicted HS-binding domains of BMP2 to BMP7. Peptides were N-terminally linked to a biotin molecule via a triple glycine linker. Kd values (in nanomolar) and pI values of synthetic peptides are shown, as well as the accession numbers for the full-length proteins from which the respective peptides were derived. B, amino acid sequences of the synthesized C-terminal peptides spanning putative HS-binding domains of BMP4, BMP5, and BMP6/7. Note that the C-terminal regions of BMP6 and BMP7 are completely identical. C, schematic of a representative BMP protein. The encoded and newly synthesized protein consists of a signal peptide (SP, green), a prodomain (yellow), and the mature biologically-active ligand (blue). A furin cleavage site separates the prodomain from the mature ligand, which contains seven conserved cysteines forming three intramolecular disulfide bonds and one intermolecular disulfide bond.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: Synthesized, Binding Assay, Derivative Assay

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: N-terminal peptides have diverse HS-binding properties compared with full-length proteins. A, N-terminal peptides from BMP2, BMP4, BMP5, BMP6, and BMP7 (designated as 2N, 4N, 5N, 6N, and 7N, respectively) were each incubated on plates coated with immobilized HS. Binding was measured using NA-HRP at an absorbance of 450 nm. Note that the N-terminal peptides from BMP2 and BMP4 interacted with HS with saturation kinetics and high affinity (Kd ∼100 nm), whereas those from BMP5, BMP6, and BMP7 did not. B, binding assays for rhBMP2, rhBMP4, and rhBMP5 to HS-coated plates. Bound proteins were detected using their respective antibodies conjugated to HRP. Note that BMP2 and BMP5 displayed saturable binding in the conditions used, whereas BMP4 binding exhibited slower kinetics. Inset shows a double-reciprocal plot for rhBMP2 and rhBMP5 with calculated Kd values of 37 and 16 nm, respectively. C, binding assays for rhBMP6 and rhBMP7. Because specific antibodies for these BMPs could not be obtained, the proteins were biotinylated using EZ-link Sulfo-NHS-LC-Biotin (ThermoFisher Scientific) prior to binding assays, and the bound proteins were then detected using NA-HRP. Inset shows a double-reciprocal plot with calculated Kd values of 56 and 40 nm for the two BMPs, respectively. Note that NA-HRP by itself elicited no signal. Each binding curve is representative of a minimum of five independent experiments.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: Binding Assay, Incubation

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: N-terminal tetrameric complexes display differential binding properties. A, architecture of a tetrameric complex assembled with NA-HRP and biotinylated peptides. Each NA-HRP molecule interacts with four peptide monomers to form a tetrameric binding complex. B, solid-phase binding assays of N-terminal peptide tetrameric complexes from BMP2 and BMP4 (designated 2N and 4N, respectively) to immobilized HS. Note that both peptide complexes bind to substrate-bound HS with saturable kinetics and are fully competed by soluble heparin (H). NA-HRP by itself elicited no signal. C, binding assays of N-terminal peptide tetrameric complexes from BMP5, BMP6, and BMP7 (designated 5N, 6N, and 7N) to substrate-bound HS. Note that all three complexes exhibit very poor binding. Each binding curve is representative of a minimum of five independent experiments.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: Binding Assay

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: C-terminal region of BMP5, BMP6, and BMP7 has high HS-binding affinity A, amino acid alignment of the C-terminal region of BMP2 and BMP4 versus BMP5, BMP6, and BMP7. Basic residues are boldface and underlined. Note that the region in BMP5, BMP6, and BMP7 contains a XBBXBX sequence that fully matches a typical CW motif, whereas the corresponding region in BMP2 and BMP4 contains nonconservative substitutions with Asn and Gln replacing a Lys and an Arg. In addition, note that the BMP2 and BMP4 regions also contain two negatively charged acidic residues (Glu and Asp) that would likely interfere with HS binding. B, solid-phase binding assays of synthetic C-terminal peptides from BMP4, BMP5, and BMP6/7 (designated 4C, 5C, and 6/7C) to substrate-bound HS. The C-terminal sequences of BMP6 and BMP7 are identical. Note that although the BMP4 peptide failed to bind HS, the BMP5 and BMP6/7 peptides did bind. C, solid-phase binding assays of tetrameric C-terminal peptide complexes from BMP4, BMP5, and BMP6/7 to HS. The BMP5 and BMP6/7 complexes bind to HS with saturable kinetics and were competed out by soluble heparin (H), whereas the tetrameric BMP4 peptide still failed to bind. Inset shows a double-reciprocal plot for BMP5 and BMP6/7 peptide tetramers. Each binding curve is representative of a minimum of five independent experiments.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: Binding Assay, Sequencing

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: N-terminal region of BMP2 and BMP4 displays a continuous electropositive surface. A–C, I-TASSER–based models of the N-terminal regions of BMP2, BMP4, and BMP5, spanning the predicted HS-binding motifs and designated as BMP2 N, BMP4 N, and BMP5 N. The N-terminal amino acid is designated by a blue dot, and the C-terminal amino acid is designated by a red dot; the backbone is in black; and Lys and Arg residues are in purple and cyan, respectively. Note that all the regions display some degree of helical structure. D–F, helical wheel diagrams of the regions shown in A–C. The wheel diagrams for BMP2 and BMP4 reveal continuous positive charge on the surface of the helix (D and E), and the BMP5 diagram presents with an unorganized and discontinuous arrangement of positive charge (F). G–I, I-TASSER–based models of the C-terminal regions of BMP2, BMP4, and BMP5 spanning the putative HS-binding motifs and designated as BMP2 C, BMP4 C, and BMP5 C. Symbols are as in A–C, but note that the region in BMP2 and BMP4 contains negatively charged residues (Asp in orange and Glu in yellow) that are inconsistent with a typical HS-binding domain and that are absent in the BMP5 region.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: Binding Assay

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: Peptides are able to interact with the cell surface. A, fluorescent N-terminal peptide tetramers from BMP2, BMP4, and BMP5 (designated 2N, 4N, and 5N, respectively) were allowed to interact with K562 cells in vitro, and binding was assessed by flow cytometry. Note that the 2N and 4N peptides vigorously interacted with the cell surface and were competed out by soluble heparin (Hep). However, the peptide from BMP5 produced minimal if any binding. The fluorescent NA backbone produced no signal on its own as did the cells (A, far left). As an additional control for binding specificity, cells were trypsinized prior to incubation with peptides, and this treatment fully prevented binding. B, fluorescent C-terminal peptide tetramers from BMP4 and BMP5 (designated 4C and 5C, respectively) were allowed to interact with K562 cells in vitro, and binding levels were assessed as above. Note that the 5C peptide did bind to the cell surface and was competed out by soluble heparin, but the 4C peptide did not bind. C, K562 cells were incubated with tetrameric complexes containing BMP2N, BMP4N, and BMP5C peptides in the absence or presence of soluble heparin (Hep), heparan sulfate (HS), or hyaluronic acid (HA) as competitors. Following incubation, the cells were washed, and the amount of bound peptide was assessed by FACS. **, p < 0.01; ***, p < 0.001; ****, p < 0.0001.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: In Vitro, Binding Assay, Flow Cytometry, Produced, Incubation

Journal: The Journal of Biological Chemistry

Article Title: Domains with highest heparan sulfate–binding affinity reside at opposite ends in BMP2/4 versus BMP5/6/7: Implications for function

doi: 10.1074/jbc.RA118.003191

Figure Lengend Snippet: HS-binding peptides stimulate chondrogenesis. A–F, day 3 mouse embryo limb bud cell micromass cultures stained with Alcian blue on day 3 following treatment with the following: vehicle control (A); NA backbone (B); rhBMP2 (C); N-terminal BMP2 peptide tetramer designated 2N (D); N-terminal BMP4 peptide tetramer designated 4N (E); and C-terminal BMP5 peptide tetramer designated 5C (F). Note that the peptides stimulated chondrogenesis as indicated by an increase in Alcian blue-positive nodules (D–F, compared with controls, A and B). G, scatter plots of levels of Alcian blue staining in A–F quantified by ImageJ. Data confirm that treatment with peptides 2N, 4N, or 5C or with rhBMP2 increased chondrogenesis over control levels (Con and NA). H–J, scatter plots of expression levels of Sox9, Col2, and aggrecan in day 3 limb bud cell cultures treated with peptide tetramers or left untreated (Con). Note that the 2N, 4N, and 5C peptides significantly increased expression of Sox9 and Col2 (H and I), whereas the strongest stimulation of aggrecan expression occurred with the 4N peptide (J). Data are averages of three independent experiments. K, scatter plots of ID1 expression in AD293 cells after treatment with vehicle (Con), NA backbone (NA), or tetrameric 2N, 4N, or 5C peptides. Each peptide stimulated ID1 expression with respect to controls. Data are averages of five independent experiments. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Article Snippet: Antibodies against human BMP2/BMP4 (BMP-2/4 (H-1): sc-137087) and BMP5 (AF6176 and MAB7151) were obtained from Santa Cruz Biotechnology (Dallas, TX) and R&D Systems (Minneapolis, MN), respectively.

Techniques: Binding Assay, Staining, Expressing